Reconstructing trees with Cassiopeia#

Cassiopeia offers several utilities for reconstructing phylogenies, carrying users from the allele tables they’ve created in the preprocessing tutorial to the full phylogeneis. This tutorial serves as a general overview of the tools that Cassiopeia offers for tree reconstruction.

[25]:
from IPython.display import Image

import numpy as np
import pandas as pd

import cassiopeia as cas

Creating character matrices#

The first step in any tree reconstruction task is the creation of character matrices. In Cassiopeia, character matrices are the fundamental data structure representing mutation information in a clonal lineage (e.g., a single embryo or a tumor).

While users can create their own, Cassiopeia offers utilities for converting allele tables into character matrices. Below, we demonstrate how this is done on an example dataset from Quinn et al.

Reading in and inspecting the data#

[26]:
# read in an allele table
allele_table = pd.read_csv("https://ftp.ncbi.nlm.nih.gov/geo/samples/GSM4905nnn/GSM4905334/suppl/GSM4905334_alleleTable.5k.txt.gz", sep='\t',
                           usecols = ['cellBC', 'intBC', 'r1', 'r2', 'r3', 'allele', 'LineageGroup', 'sampleID', 'readCount', 'UMI'])

As you see below, this allele table reports on the allelic information for each intBC in each cellBC. In addition, we have annotated each cellBC by which clone it came from (denoted by the LineageGroup column) and which tissue it came from (denoted by the sampleID column). Before reconstructing trees, we’ll want to select a specific clone for reconstruction – recall that we want to only reconstruct trees for clonally-related cells!

Warning: The semantics used above correspond specifically to the molecular recorder technology described in Chan et al, 2019. Depending on your technology, you might not have the equivalent of intBCs or lineage-groups. For example, the GESTALT technology as described in Raj et al, 2018 does not have intBCs. Moreover, be sure you know what a “clonal” population indicates in your dataset - for example, each embryo might be considered a clonal population.

[3]:
allele_table.head(5)
[3]:
cellBC intBC r1 r2 r3 allele LineageGroup sampleID readCount UMI
0 RW.TTTGTCATCAGCTCGG-1 CTCCCCCAATACCG GACAA[115:23I]CTTAACTTTGTATGGTCCTTTGTATGGC TAACG[163:27D]ATGTC TAATT[219:2D]CGGAG GACAA[115:23I]CTTAACTTTGTATGGTCCTTTGTATGGCTAAC... 24 RW 529 9
1 RW.TTTGTCATCAGCTCGG-1 ACACATAACTTTAG CGCCG[111:1I]AAAAAA ACGAT[165:25D]ATGTC TAATT[219:2D]CGGAG CGCCG[111:1I]AAAAAAACGAT[165:25D]ATGTCTAATT[21... 24 RW 719 14
2 RW.TTTGTCATCAGCTCGG-1 AGATAACGGCAAGT CCTTT[103:34D]GCACG GTCAT[159:9D]GTTGG AATTC[220:1I]TGCGGA CCTTT[103:34D]GCACGGTCAT[159:9D]GTTGGAATTC[220... 24 RW 459 9
3 RW.TTTGTCATCAGCTCGG-1 CACACTCACGATGA CGCCG[111:1I]AAAAAA CGATA[166:4D]TGGTT TAATT[219:2D]CGGAG CGCCG[111:1I]AAAAAACGATA[166:4D]TGGTTTAATT[219... 24 RW 760 10
4 RW.TTTGTCATCAGCTCGG-1 CATACGCCATGAGG CGCCG[111:1I]AAAAAA GATAT[None]CTCTG TAGCA[206:42D]GTCTT CGCCG[111:1I]AAAAAAGATAT[None]CTCTGTAGCA[206:4... 24 RW 351 6

Estimating indel priors#

Because we’ve sampled ~100 clonal populations, we can leverage the fact that each of these clones represents an independent lineage-tracing experiment to estimate the probability of a particular indel occurring. This will be helpful for reconstruction tasks downstream.

To do this, we use cas.pp.compute_empirical_indel_priors. Here we treat each intBC in each clonal population as an independent group so we’ll estimate priors by counting the proportion of times that an indel appeared on a intBC

[4]:
indel_priors = cas.pp.compute_empirical_indel_priors(allele_table, grouping_variables=['intBC', 'LineageGroup'])

After doing this, we can observe the most frequent indels, appearing on most intBCs across our dataset.

[5]:
indel_priors.sort_values(by='count', ascending=False).head()
[5]:
count freq
indel
CGCCG[111:1I]AAAAAA 832.0 0.797699
TAATT[219:2D]CGGAG 713.0 0.683605
CGATA[166:1I]TTCTCT 611.0 0.585810
AATTC[220:1I]GGCGGA 610.0 0.584851
ATTCG[221:1D]GGAGG 524.0 0.502397

With indel priors calculated, we’ll subset our allele table to a clone of interest and create a character matrix. This can be done by passing the clone’s allele table to cas.pp.convert_alleletable_to_character_matrix which will transform the allele table into an N x M character matrix. We’ll also pass in the indel priors we just computed, which will be transformed into a dictionary relating each unique state observed in each character to a probability. This new priors object will be specific to the character matrix we’re computing.

The function for converting allele tables to character matrices has additional capabilities for filtering out low-information characters. Not only can users specify a subset of intBCs to ignore, but we can also filter out characters by dominated by a single state (this proportion can be controlled by allele_rep_thresh). Here we filter out characters that have an indel spanning more than 90% of cells.

[6]:
CLONE = 45
clone_allele_table = allele_table[allele_table['LineageGroup'] == CLONE]

n_cells = clone_allele_table['cellBC'].nunique()
n_intbc = clone_allele_table['intBC'].nunique()

print(f"Clonal population #{CLONE} has {n_cells} cells and {n_intbc} intBCs ({n_intbc * 3}) characters.")
Clonal population #45 has 98 cells and 26 intBCs (78) characters.
[7]:
character_matrix, priors, state_2_indel = cas.pp.convert_alleletable_to_character_matrix(clone_allele_table,
                                                                                         allele_rep_thresh = 0.9,
                                                                                         mutation_priors = indel_priors)
Dropping the following intBCs due to lack of diversity with threshold 0.9: ['CCGTTCCAATTGTGr3', 'GACTCATGACACTTr1', 'TCAATGAGAGTTCTr1', 'TCAATGAGAGTTCTr2', 'TCAATGAGAGTTCTr3', 'TTCTTTTTACCGCGr1', 'TTCTTTTTACCGCGr2', 'CCCGAGCTAATCCTr3']

The data struture#

This simple data structure is an N x M matrix, where we represent each of the N cells in a population by a vector of M characters that can take on a mutation. In the context of Cas9-based lineage tracers, each of these M characters is a specific cut-site that can take on one of several possible indels. The entry \(n_{i, j}\) represents that mutation observed in the \(i^{th}\) cell at the \(j^{th}\) cut-site. For simplicity, we abstract away actual indentities and represent each unique mutation as integer, so that these character matrices are filled with integers. Importantly, Cassiopeia represents missing data with the integer -1, though users can change this as long as they specify this to the CassiopeiaTree downstream.

[8]:
character_matrix.head(5)
[8]:
r1 r2 r3 r4 r5 r6 r7 r8 r9 r10 ... r61 r62 r63 r64 r65 r66 r67 r68 r69 r70
RW.TTTGCGCCAAGAAAGG-1 0 0 1 0 0 1 0 0 1 1 ... -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GTTCTCGAGGGTTTCT-1 0 0 0 0 0 0 1 0 1 1 ... -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GTCATTTTCCATTCTA-1 1 1 2 0 0 2 0 0 1 1 ... 0 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GGGATGATCGCGCCAA-1 2 2 3 0 0 0 2 1 2 0 ... 0 0 0 0 1 0 0 0 0 0
RW.GGCTGGTAGTCAATAG-1 0 0 1 0 0 1 0 0 1 1 ... 0 -1 -1 -1 -1 -1 -1 -1 -1 -1

5 rows × 70 columns

We can also observe the new prior dictionary we created. Indexing the dictionary by 0 gives the priors for the states observed in the 1st character.

Heads up: States are not consistent across characters, so priors need not align between characters. Do not be alarmed if state 1 has a different prior between characters!

[9]:
priors[0]
[9]:
{1: 0.003835091083413231,
 2: 0.0009587727708533077,
 3: 0.0028763183125599234,
 4: 0.0009587727708533077,
 5: 0.26558005752636626,
 6: 0.23585810162991372,
 7: 0.01725790987535954,
 8: 0.7976989453499521,
 9: 0.0028763183125599234}

Reconstructing trees#

With the character matrix and priors we just created, we are ready to reconstruct trees! Cassiopeia offers a general interface for working with trees, including reconstruction.

Working with CassiopeiaTrees#

At its core is the CassiopeiaTree class – this is a general data structure that can store tree topologies, character matrices (with various layers), priors, branch lengths, and other meta data. Importantly, all of our solvers derive from a central CassiopeiaSolver class that at a minimum implements a single function - solve - that ingests a CassiopeiaTree and populates the tree topology within the object. To see how this works, let’s work with the character matrix we just created above.

[10]:
cas_tree = cas.data.CassiopeiaTree(character_matrix=character_matrix, priors=priors)

The CassiopeiaTree constructor will populate the object automatically with the specified information which we can explore here.

[11]:
cas_tree.character_matrix.head(5)
[11]:
r1 r2 r3 r4 r5 r6 r7 r8 r9 r10 ... r61 r62 r63 r64 r65 r66 r67 r68 r69 r70
RW.TTTGCGCCAAGAAAGG-1 0 0 1 0 0 1 0 0 1 1 ... -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GTTCTCGAGGGTTTCT-1 0 0 0 0 0 0 1 0 1 1 ... -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GTCATTTTCCATTCTA-1 1 1 2 0 0 2 0 0 1 1 ... 0 -1 -1 -1 -1 -1 -1 -1 -1 -1
RW.GGGATGATCGCGCCAA-1 2 2 3 0 0 0 2 1 2 0 ... 0 0 0 0 1 0 0 0 0 0
RW.GGCTGGTAGTCAATAG-1 0 0 1 0 0 1 0 0 1 1 ... 0 -1 -1 -1 -1 -1 -1 -1 -1 -1

5 rows × 70 columns

[12]:
cas_tree.n_cell, cas_tree.n_character,
[12]:
(98, 70)
[13]:
cas_tree.priors[0]
[13]:
{1: 0.003835091083413231,
 2: 0.0009587727708533077,
 3: 0.0028763183125599234,
 4: 0.0009587727708533077,
 5: 0.26558005752636626,
 6: 0.23585810162991372,
 7: 0.01725790987535954,
 8: 0.7976989453499521,
 9: 0.0028763183125599234}

We can also add important cellular-level and character-level meta data to the CassiopeiaTree object:

[14]:
cell_meta = clone_allele_table.groupby('cellBC').agg({"intBC": 'nunique', 'UMI': 'sum', 'sampleID': 'unique'})
cell_meta['sampleID'] = [x[0] for x in cell_meta['sampleID']]

missing_proportion = (character_matrix == -1).sum(axis=0) / character_matrix.shape[0]
uncut_proportion = (character_matrix == 0).sum(axis=0) / character_matrix.shape[0]
n_unique_states = character_matrix.apply(lambda x: len(np.unique(x[(x != 0) & (x != -1)])), axis=0)

character_meta = pd.DataFrame([missing_proportion, uncut_proportion, n_unique_states], index = ['missing_prop', 'uncut_prop', 'n_unique_states']).T

cas_tree.cell_meta = cell_meta
cas_tree.character_meta = character_meta
[15]:
cas_tree.cell_meta.head(5)
[15]:
intBC UMI sampleID
cellBC
Liv.CAGTAACGTTGCTCCT-1 22 557 Liv
Liv.CGATTGAAGGTGCTAG-1 20 475 Liv
M1.AAACCTGCACGCCAGT-1 14 33 M1
M1.AAAGATGCAGCGTAAG-1 12 37 M1
M1.AAAGTAGAGCCAGTTT-1 23 96 M1
[16]:
cas_tree.character_meta.head(5)
[16]:
missing_prop uncut_prop n_unique_states
r1 0.479592 0.357143 9.0
r2 0.479592 0.295918 14.0
r3 0.479592 0.377551 8.0
r4 0.255102 0.112245 5.0
r5 0.255102 0.510204 14.0

Creating and working with CassiopeiaSolvers#

As mentioned previously, Cassiopeia works with a general class of CassiopeiaSolvers. We have implemented several solvers, which you can find here.

Perhaps the most popular are the VanillaGreedySolver, ILPSolver, HybridSolver, and NeighborJoiningSolver. Here, we’ll provide a quick overview of each of these.

Tip: We recommend using a panel of solvers for your reconstruction tasks. It is rare for a particular solver to be optimal over all parts of the tree, so using a few different solvers can give you an idea of relative certainty over any downstream tasks.

Heads up: If priors are specified in the CassiopeiaTree object, they will automatically be used in the solver.

We’ll use the VanillaGreedySolver to showcase the basics of the solver API.

[17]:
# create a basic vanilla greedy solver
vanilla_greedy = cas.solver.VanillaGreedySolver()

# reconstruct the tree
vanilla_greedy.solve(cas_tree, collapse_mutationless_edges=True)
[79]:
# plot tree
cas.pl.upload_and_export_itol(cas_tree, itol_config="~/.itolconfig_hidden",
                              tree_name = "example_greedy_tree", export_filepath="example_greedy_tree.png")
iTOL output: SUCCESS: 12832112124272501627507287

Tree Web Page URL: http://itol.embl.de/external.cgi?tree=12832112124272501627507287&restore_saved=1
Warnings: []
[81]:
Image("example_greedy_tree.png", width=500, height=500)
[81]:
../_build/doctrees/nbsphinx/notebooks_reconstruct_30_0.png

Neighbor-Joining#

The NeighborJoiningSolver extends the DistanceSolver class which additionally takes into the constructor a dissimilarity map (or, a function that be used to relate two samples to one another). We’ve implemented several dissimilary maps in the cas.solver.dissimilarity library but suggest any technology using a Cas9 recorder use the modified_hamming_distance function.

To note, since Neighbor-Joining returns an unrooted tree, we attempt to re-root the tree. This can be done by adding a sample corresponding to the uncut-state (this is accomplished by setting add_root=True) or by specifying a sample in the character matrix to treat as an outgroup.

Tip: A user can impelement their own dissimilarity map, as long as it takes in two character state vectors and weights, and returns a positive value representing a dissimilarity. Ideally, the function is optimizable with Numba but this is not needed.

[20]:
nj_solver = cas.solver.NeighborJoiningSolver(dissimilarity_function=cas.solver.dissimilarity.weighted_hamming_distance, add_root=True)
nj_solver.solve(cas_tree, collapse_mutationless_edges=True)
[21]:
# plot tree
cas.pl.upload_and_export_itol(cas_tree, itol_config="~/.itolconfig_hidden",
                              tree_name = "example_nj_tree", export_filepath="example_nj_tree.png")
iTOL output: SUCCESS: 12832112124301621627508485

Tree Web Page URL: http://itol.embl.de/external.cgi?tree=12832112124301621627508485&restore_saved=1
Warnings: []
[22]:
Image("example_nj_tree.png", width=500, height=500)
[22]:
../_build/doctrees/nbsphinx/notebooks_reconstruct_34_0.png

ILPSolver#

The ILPSolver is an implementaion of Steiner-Tree approach described in Jones et al, 2020. The constructor takes in several options controlling the size and complexity of the potential graph to infer as well as stopping criteria for the integer-linear program (ILP) optimization routine.

There are several parameters of interest which can all be explored on our documentation website. Because this process can take a long time, we’ll restrict the potential graph layer size to 500 nodes and the convergence time to 500s. A more realistic solver might use our defaults - namely, a maximum potential graph layer size of 10,000 and a convergence time of 12,600s (3.5hr).

Heads up: Please re-read the paragraph above - these settings are for the toy example, a more realistic solver will use the ILPSolver defaults.

The ILPSolver logs the progress of the potential graph inference and optimization in a user-defined logfile (by default, stdout.log). This logfile will also be output here.

Heads up: Make sure to have followed the instructions to install Gurobi before proceeding with this solver.

[18]:
ilp_solver = cas.solver.ILPSolver(convergence_time_limit=500, # recommended: 12600
                                  maximum_potential_graph_layer_size=500, # recommended: 10000
                                  weighted=True,
                                  seed=1234)
ilp_solver.solve(cas_tree)

Reading the logfile#

The logfile from the ILPSolver contains several pieces of information helpful for assessing the effectiveness of the inference.

The first lines of the log convey the parameters used for the solver.

The next step of lines (preceded by “Process: …”) indicate the complexity of the potential graph inference. Each line indicates how large the potential graph is after adding ancestors up to an LCA distance of \(x\). This process will terminate if a maximum layer size or maximum LCA distance is exceeded, whichever is first.

Finally, the log stores the output from the Gurobi optimization routine. This part of the logfile consists of several columns, but the most important two for most use cases are “Gap” and “Time”, which store the convergence gap and amount of elapsed time. The ILP will terminate once the gap falls below the specified mip_gap or exceeds the specified convergence_time_limit or convergence_iteration_limit parameters.

The last few lines of the log after the ILP has finished will indicate whether or not an optimal model was found. To note, it is quite rare for an optimal model to be found so any tree inferred with an ILPSolver should be treated as a near-optimal model.

[19]:
!head -50 stdout.log
[2021-07-28 15:30:05,538]    INFO [ILPSolver] Solving tree with the following parameters.
[2021-07-28 15:30:05,540]    INFO [ILPSolver] Convergence time limit: 500
[2021-07-28 15:30:05,562]    INFO [ILPSolver] Convergence iteration limit: 0
[2021-07-28 15:30:05,562]    INFO [ILPSolver] Max potential graph layer size: 500
[2021-07-28 15:30:05,596]    INFO [ILPSolver] Max potential graph lca distance: None
[2021-07-28 15:30:05,617]    INFO [ILPSolver] MIP gap: 0.01
[2021-07-28 15:30:06,350]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) Estimating a potential graph with a maximum layer size of 500 and a maximum LCA distance of 75.
[2021-07-28 15:30:16,255]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) LCA distance 0 completed with a neighborhood size of 145.
[2021-07-28 15:30:31,152]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) LCA distance 1 completed with a neighborhood size of 145.
[2021-07-28 15:32:29,951]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) LCA distance 2 completed with a neighborhood size of 433.
[2021-07-28 15:34:02,390]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) LCA distance 3 completed with a neighborhood size of 390.
[2021-07-28 15:36:04,065]    INFO [ILPSolver] (Process: 87e61250efe7f98c8eeaeeac4e2cd38b) LCA distance 4 completed with a neighborhood size of 454.

Gurobi 8.1.1 (linux64) logging started Wed Jul 28 15:37:01 2021

Changed value of parameter LogFile to stdout.log
   Prev: gurobi.log  Default:
Changed value of parameter Seed to 1234
   Prev: 0  Min: 0  Max: 2000000000  Default: 0
Changed value of parameter TimeLimit to 500.0
   Prev: 1e+100  Min: 0.0  Max: 1e+100  Default: 1e+100
Optimize a model with 33045 rows, 63928 columns and 127856 nonzeros
Variable types: 0 continuous, 63928 integer (31964 binary)
Coefficient statistics:
  Matrix range     [1e-02, 1e+00]
  Objective range  [3e-03, 1e+00]
  Bounds range     [1e+00, 1e+02]
  RHS range        [1e+00, 1e+02]
Presolve removed 1155 rows and 1162 columns
Presolve time: 0.35s
Presolved: 31890 rows, 62766 columns, 125618 nonzeros
Variable types: 0 continuous, 62766 integer (31143 binary)
Presolve removed 31014 rows and 31371 columns
Presolved: 876 rows, 31395 columns, 62748 nonzeros


Root relaxation: objective 3.415817e+01, 1246 iterations, 0.20 seconds

    Nodes    |    Current Node    |     Objective Bounds      |     Work
 Expl Unexpl |  Obj  Depth IntInf | Incumbent    BestBd   Gap | It/Node Time

     0     0   34.15817    0  212          -   34.15817      -     -    1s
H    0     0                      56.7400210   34.15817  39.8%     -    1s
H    0     0                      56.5147214   34.15817  39.6%     -    1s
H    0     0                      53.3865615   34.15817  36.0%     -    1s
     0     0   38.29837    0  369   53.38656   38.29837  28.3%     -    2s
H    0     0                      50.2939952   38.29837  23.9%     -    2s
H    0     0                      48.4887360   38.29837  21.0%     -    3s
H    0     0                      48.3026877   38.29837  20.7%     -    3s
     0     0   38.81690    0  397   48.30269   38.81690  19.6%     -    3s
[21]:
rndict = {}
_iter = 0
for n in cas_tree.nodes:
    if ',' in n:
        rndict[n] = f'node{_iter}'
        _iter += 1

cas_tree.relabel_nodes(rndict)
[22]:
# plot tree
cas.pl.upload_and_export_itol(cas_tree, itol_config="~/.itolconfig_hidden",
                              tree_name = "example_ilp_tree", export_filepath="example_ilp_tree.png")
iTOL output: SUCCESS: 12832112124417641627512395

Tree Web Page URL: http://itol.embl.de/external.cgi?tree=12832112124417641627512395&restore_saved=1
Warnings: []
[23]:
Image("example_ilp_tree.png", width=500, height=500)
[23]:
../_build/doctrees/nbsphinx/notebooks_reconstruct_41_0.png

HybridSolver#

The HybridSolver class implemented in Cassiopeia is a flexible class that takes in two solvers: first, a top-down greedy solver (this must be an class that inherits from the GreedySolver class) and a bottom-solver of any type. Here, we’ll show how this class can be used by using the Cassiopeia-Hybrid solver described in Jones et al, 2020 that combines the VanillaGreedySolver with the ILPSolver.

While the HybridSolver will use the parameters set in its respective top and bottom solvers, a user will need to specify cutoff criteria for transitioning between the top and bottom solver, as well as the number of threads to use. Here, we’ll use an cell cutoff of 20 for transitioning between Greedy and ILP, and use the ILPSolver and VanillaGreedySolvers that were instantiated above.

[ ]:
hybrid_solver = cas.solver.HybridSolver(top_solver=vanilla_greedy, bottom_solver=ilp_solver, cell_cutoff=40, threads=10)
hybrid_solver.solve(cas_tree, logfile='example_hybrid.log')

Interpreting the log files#

The HybridSolver will create a logfile for each sub-problem, and will output any output speicfic to that problem to this specific log file. These logfiles will all share the same stem (e.g., ‘example_hybrid’), but have indicate which the root of the sub-problem (these are nodes in the in-progress tree).

[20]:
!ls | grep 'example_hybrid'
example_hybrid_0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0.log
example_hybrid_0-0-0-4-0-0-0-0-0-6-0-2-0-0-0-0-0-0-7-5-0-0-0-3-4-0-0-0-0-3-0--1--1--1-0-0-0-0-0-0-0-0-0-0-3-0-0-0-0-0-0-0-0-2-3-0-0-3-0-0-0-3-0-0-0-4-0-0-0-2.log
example_hybrid_0-0-0-4-0-0-0-0-0-6-0-2-0-0-0-0-0-0-7-5-0-0-0-3-4-0-0-0-0-3-0--1--1--1-0-0-0-0-0-0-0-0-0-0-3-0-0-0-0-0-3-0-0-2-3-0-0-3-0-0-0-3-0-0-0-4-0-0-0-0.log
example_hybrid_0-0-0-4-0-0-12-0-0-6-0-2-0-0-0-0-6-5-7-5-0-0-0-3-4-0-0-0-2-3-0--1--1--1-0-0-0-0-0-0-0-0-0-3-4-0-0-0-0-0-0-0-0-2-3-0-0-3-1-0-0-3-0-1-0-4-0-2-0-2.log
example_hybrid_0-5-0-4-7-0-0-0-0-6-0-2-0-0-0-0-0-0-7-5-0-0-0-3-4-0-0-0-0-3-0--1--1--1-0-0-0-0-0-0-0-0-0-3-3-0--1--1--1--1--1--1--1-2-4-0--1--1-0-0-0-3-3-5-0-4-0-0-0-2.log
example_hybrid_0-9-6-4-0-0-0-0-0-6-0-2-6-0-0-0-0-0-7-5-0-0-0-3-4-0-0-0-0-3-0--1--1--1-0-0-0-0-0-0-0-0-0-0-3-0-0-0-0-0-0-0-0-2-3-0-0-3-0-0-0-3-0-0-0-4-0-0-0-2.log
example_hybrid_-1--1--1-4-0-0-0-0-0-6-0-2-0-0-0-5-0-0-7-5-0-0-0-3-4-0-0-0-0-3-0--1--1--1-0-0-0-0-0-0-0-0-0-0-3-0-0-0-0-0-0-0-0-2-3-0-0-3-0-0-0-3-0-0-0-4-0-0-0-2.log
example_hybrid_2-2-3-0-0-0-0-0-0-0-0-0-2-0-2-0-0-0-7-5-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-2-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0.log
[22]:
rndict = {}
_iter = 0
for n in cas_tree.nodes:
    if ',' in n:
        rndict[n] = f'node{_iter}'
        _iter += 1

cas_tree.relabel_nodes(rndict)
[23]:
# plot tree
cas.pl.upload_and_export_itol(cas_tree, itol_config="~/.itolconfig_hidden",
                              tree_name = "example_hybrid_tree", export_filepath="example_hybrid_tree.png")
iTOL output: SUCCESS: 12832112124430351627521566

Tree Web Page URL: http://itol.embl.de/external.cgi?tree=12832112124430351627521566&restore_saved=1
Warnings: []
[24]:
Image("example_hybrid_tree.png", width=500, height=500)
[24]:
../_build/doctrees/nbsphinx/notebooks_reconstruct_48_0.png
[ ]: